ID: 916728559_916728567

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 916728559 916728567
Species Human (GRCh38) Human (GRCh38)
Location 1:167545629-167545651 1:167545678-167545700
Sequence CCACCCTCTTTATGAAAATACAA GCCTGTATTCCCAGCTGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 65, 4: 596} {0: 28, 1: 3008, 2: 77966, 3: 268300, 4: 502095}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!