ID: 916732287_916732289

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 916732287 916732289
Species Human (GRCh38) Human (GRCh38)
Location 1:167577071-167577093 1:167577091-167577113
Sequence CCTTTTAATCACTGCCAAATAAA AAAACCCTGTACCCATTAAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 48, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!