ID: 916738592_916738597

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 916738592 916738597
Species Human (GRCh38) Human (GRCh38)
Location 1:167629584-167629606 1:167629602-167629624
Sequence CCTCCTCCTCCTCCTTCTACTCG ACTCGTATACAGAAGATAGATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 350, 3: 4564, 4: 12189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!