ID: 916739441_916739446

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 916739441 916739446
Species Human (GRCh38) Human (GRCh38)
Location 1:167635519-167635541 1:167635542-167635564
Sequence CCTCACAGCACTGCGAGCCAGAG CTTGGCGCGCGCGGTTCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 191} {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!