ID: 916748255_916748260

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 916748255 916748260
Species Human (GRCh38) Human (GRCh38)
Location 1:167701048-167701070 1:167701064-167701086
Sequence CCTTGCCACTTCCGTATTCCCAA TTCCCAACAGAGCCTTGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121} {0: 1, 1: 0, 2: 4, 3: 18, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!