ID: 916755068_916755076

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 916755068 916755076
Species Human (GRCh38) Human (GRCh38)
Location 1:167761586-167761608 1:167761636-167761658
Sequence CCAGAGGAAGTGGAAATTTGAGG CTAGGGAAATGGAAAGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 249} {0: 1, 1: 0, 2: 3, 3: 54, 4: 480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!