ID: 916756160_916756165

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 916756160 916756165
Species Human (GRCh38) Human (GRCh38)
Location 1:167772006-167772028 1:167772029-167772051
Sequence CCAGGCAGTCGGCAGCCCGAGGC AGGAGAATCACAGGAGCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 39, 3: 246, 4: 562} {0: 5, 1: 36, 2: 89, 3: 625, 4: 3643}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!