ID: 916785822_916785825

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 916785822 916785825
Species Human (GRCh38) Human (GRCh38)
Location 1:168086457-168086479 1:168086483-168086505
Sequence CCTTACATTTTCTGGAAAGTAGG CCTGTACCCCACTCTCCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 78, 4: 1191} {0: 1, 1: 0, 2: 0, 3: 19, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!