ID: 916787035_916787040

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 916787035 916787040
Species Human (GRCh38) Human (GRCh38)
Location 1:168093848-168093870 1:168093885-168093907
Sequence CCACATTCTGCTTTGGTTCCCAG TGCTGCCTCCTCCTGGGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 300} {0: 1, 1: 0, 2: 7, 3: 47, 4: 418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!