|
Left Crispr |
Right Crispr |
| Crispr ID |
916791874 |
916791881 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:168132303-168132325
|
1:168132335-168132357
|
| Sequence |
CCAAGCCGGGCGCTGTGGCTCTC |
CCCAGCACTTTGGGAGGTCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 165, 3: 2350, 4: 6507} |
{0: 3341, 1: 124982, 2: 268208, 3: 211109, 4: 126311} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|