|
Left Crispr |
Right Crispr |
| Crispr ID |
916791874 |
916791883 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:168132303-168132325
|
1:168132338-168132360
|
| Sequence |
CCAAGCCGGGCGCTGTGGCTCTC |
AGCACTTTGGGAGGTCGAGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 165, 3: 2350, 4: 6507} |
{0: 2438, 1: 95371, 2: 188205, 3: 135654, 4: 71168} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|