ID: 916792375_916792378

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 916792375 916792378
Species Human (GRCh38) Human (GRCh38)
Location 1:168136233-168136255 1:168136247-168136269
Sequence CCCGGCTGGGAGAAGGCTGCTCA GGCTGCTCACCTGGTCCTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 263} {0: 1, 1: 0, 2: 2, 3: 21, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!