|
Left Crispr |
Right Crispr |
| Crispr ID |
916797643 |
916797651 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:168181500-168181522
|
1:168181545-168181567
|
| Sequence |
CCGCACCCGGCCTCCTCTCCATA |
GATTGGTGCAAAAGTAATTGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 11, 3: 114, 4: 848} |
{0: 136, 1: 1359, 2: 2020, 3: 1460, 4: 947} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|