ID: 916808158_916808162

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 916808158 916808162
Species Human (GRCh38) Human (GRCh38)
Location 1:168280368-168280390 1:168280408-168280430
Sequence CCCTGGGAGAAAGAGATTCTGAG GAGCCCTGACCCTTGAGCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!