ID: 916898976_916898984

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 916898976 916898984
Species Human (GRCh38) Human (GRCh38)
Location 1:169200487-169200509 1:169200532-169200554
Sequence CCAGCCATCTTCTAGAGATAATA CTTTCATATGCAAACCAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 397} {0: 1, 1: 1, 2: 2, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!