ID: 916917045_916917049

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 916917045 916917049
Species Human (GRCh38) Human (GRCh38)
Location 1:169418200-169418222 1:169418247-169418269
Sequence CCTCTTCACTACAGCACTGTTAA AAATATCTACAAATGAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 205} {0: 1, 1: 1, 2: 7, 3: 60, 4: 775}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!