ID: 916933566_916933578

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 916933566 916933578
Species Human (GRCh38) Human (GRCh38)
Location 1:169604789-169604811 1:169604832-169604854
Sequence CCACAGAACCCATTTCCAGCTCT CAGCAGGGGTAGATGTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 314} {0: 1, 1: 0, 2: 3, 3: 36, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!