ID: 916936108_916936115

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 916936108 916936115
Species Human (GRCh38) Human (GRCh38)
Location 1:169629840-169629862 1:169629879-169629901
Sequence CCACGATGGCTTTATTTGTAAAA AACTCACAAGGGTGTTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 502} {0: 1, 1: 0, 2: 1, 3: 21, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!