ID: 916948666_916948670

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 916948666 916948670
Species Human (GRCh38) Human (GRCh38)
Location 1:169757433-169757455 1:169757482-169757504
Sequence CCAGATTCTAACTTACTAGCTGG ATAAAGACATACCCCAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92} {0: 75, 1: 3426, 2: 7403, 3: 9059, 4: 10679}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!