ID: 916952426_916952435

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 916952426 916952435
Species Human (GRCh38) Human (GRCh38)
Location 1:169794661-169794683 1:169794709-169794731
Sequence CCCGCGGCTAGGAACGCGCCTCT TTGGAGTCACTTCCGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 28} {0: 1, 1: 0, 2: 0, 3: 10, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!