ID: 916952467_916952473

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 916952467 916952473
Species Human (GRCh38) Human (GRCh38)
Location 1:169794882-169794904 1:169794904-169794926
Sequence CCTCCGGACCTAAATCGCGCACC CAGTGAGTCGAGTCCTCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 7} {0: 1, 1: 0, 2: 0, 3: 7, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!