ID: 916983278_916983282

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 916983278 916983282
Species Human (GRCh38) Human (GRCh38)
Location 1:170163030-170163052 1:170163043-170163065
Sequence CCGTGTGGAATGCCAAGCTGACC CAAGCTGACCACAGGGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110} {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!