|
Left Crispr |
Right Crispr |
| Crispr ID |
917111799 |
917111817 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:171556358-171556380
|
1:171556401-171556423
|
| Sequence |
CCCCCCACCCCTTGTGCTTCCTG |
TGCTTTGGCTCACCCTCCGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 51, 2: 142, 3: 281, 4: 775} |
{0: 49, 1: 263, 2: 533, 3: 981, 4: 1057} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|