ID: 917118056_917118060

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 917118056 917118060
Species Human (GRCh38) Human (GRCh38)
Location 1:171622289-171622311 1:171622309-171622331
Sequence CCCTGCGACATCTGTGGAGATTT TTTCTCAAGGACACGGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81} {0: 1, 1: 0, 2: 1, 3: 18, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!