ID: 917122776_917122783

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 917122776 917122783
Species Human (GRCh38) Human (GRCh38)
Location 1:171659044-171659066 1:171659089-171659111
Sequence CCATCTAATTTCTAAATATTATG TATGAACTTTAGGCCGGGCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 42, 3: 356, 4: 2028}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!