ID: 917133275_917133286

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 917133275 917133286
Species Human (GRCh38) Human (GRCh38)
Location 1:171763712-171763734 1:171763756-171763778
Sequence CCTCCCTTCTGGGTAAGGCAGCC TTCAGGCTACACCAAGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 187} {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!