ID: 917141633_917141645

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 917141633 917141645
Species Human (GRCh38) Human (GRCh38)
Location 1:171841457-171841479 1:171841501-171841523
Sequence CCTGCCCGCCCGCGCAGGCGCGC GCCAAGCGGCGGGCTGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 347} {0: 1, 1: 0, 2: 2, 3: 12, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!