ID: 917146503_917146506

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 917146503 917146506
Species Human (GRCh38) Human (GRCh38)
Location 1:171897451-171897473 1:171897476-171897498
Sequence CCACAAATGTCAAGGATAGACCT AATGAGTAGAACAGATGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 185} {0: 1, 1: 0, 2: 4, 3: 44, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!