ID: 917159299_917159306

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 917159299 917159306
Species Human (GRCh38) Human (GRCh38)
Location 1:172039767-172039789 1:172039808-172039830
Sequence CCTCCTGCCTTCCTTTCTCTGTT CTCTTCATGCACTCAGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 31, 3: 289, 4: 2043} {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!