ID: 917188543_917188552

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 917188543 917188552
Species Human (GRCh38) Human (GRCh38)
Location 1:172388758-172388780 1:172388788-172388810
Sequence CCCCTCCACAAGTTCCATCTAGG GGGCCCCGCCCAGTGTCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 0, 4: 98} {0: 1, 1: 0, 2: 1, 3: 17, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!