ID: 917193517_917193530

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 917193517 917193530
Species Human (GRCh38) Human (GRCh38)
Location 1:172443771-172443793 1:172443791-172443813
Sequence CCCAAAAGGGCAGCGCCCGCCCG CCGCAGAGTGGGGCTGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53} {0: 1, 1: 0, 2: 2, 3: 73, 4: 572}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!