ID: 917295894_917295903

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 917295894 917295903
Species Human (GRCh38) Human (GRCh38)
Location 1:173518909-173518931 1:173518945-173518967
Sequence CCCCCAAGATTCCTGTCTGTTGT AATCTAGGGACTGCAGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 191} {0: 1, 1: 0, 2: 9, 3: 44, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!