|
Left Crispr |
Right Crispr |
| Crispr ID |
917304449 |
917304454 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:173612614-173612636
|
1:173612650-173612672
|
| Sequence |
CCTTCCACAGTCTCCCTCTGATG |
GGACTGTACTGCTGCCATCTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 88, 2: 17, 3: 35, 4: 370} |
{0: 791, 1: 492, 2: 154, 3: 345, 4: 7246} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|