ID: 917329633_917329637

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 917329633 917329637
Species Human (GRCh38) Human (GRCh38)
Location 1:173868327-173868349 1:173868341-173868363
Sequence CCGCTCCGTGGGAGGGGGTGGGG GGGGTGGGGGATTTCACTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 455} {0: 1, 1: 0, 2: 1, 3: 17, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!