ID: 917329984_917329990

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 917329984 917329990
Species Human (GRCh38) Human (GRCh38)
Location 1:173870731-173870753 1:173870777-173870799
Sequence CCCCAAAGGGAAACCGGCGAGGT CAGAGAGCTAAGTCCTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52} {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!