ID: 917339877_917339885

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 917339877 917339885
Species Human (GRCh38) Human (GRCh38)
Location 1:173965046-173965068 1:173965070-173965092
Sequence CCCACCTCATTAAGTTGACCCAA GAGGCACTCAAGGGTCTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120} {0: 1, 1: 0, 2: 2, 3: 16, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!