ID: 917343044_917343047

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 917343044 917343047
Species Human (GRCh38) Human (GRCh38)
Location 1:173999939-173999961 1:173999983-174000005
Sequence CCAGGCTGGTACTTTGAAACTCT ATAAAAGTTTATAGTAATTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 228} {0: 1, 1: 0, 2: 3, 3: 49, 4: 581}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!