|
Left Crispr |
Right Crispr |
| Crispr ID |
917361128 |
917361130 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:174177264-174177286
|
1:174177301-174177323
|
| Sequence |
CCGCATAAATGTCTTCTTTTGAG |
ATCCTTCGCCTACTTTTGATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1580, 1: 1463, 2: 1351, 3: 2048, 4: 4205} |
{0: 4, 1: 7, 2: 90, 3: 376, 4: 3142} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|