ID: 917361440_917361442

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 917361440 917361442
Species Human (GRCh38) Human (GRCh38)
Location 1:174180904-174180926 1:174180941-174180963
Sequence CCTGGTACTTGTTTCATGCTTTA TTTAAGATCAATATGTGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 202} {0: 1, 1: 0, 2: 0, 3: 18, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!