ID: 917380533_917380537

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 917380533 917380537
Species Human (GRCh38) Human (GRCh38)
Location 1:174401394-174401416 1:174401412-174401434
Sequence CCTAATACATGATAAGCACTCAC CTCACCCGTGATGGGGAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 340} {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!