ID: 917397037_917397045

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 917397037 917397045
Species Human (GRCh38) Human (GRCh38)
Location 1:174604346-174604368 1:174604396-174604418
Sequence CCCACAATCACTGTCCTCTCCCT TGCCATGCAGCTAATGCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 28, 2: 89, 3: 206, 4: 501} {0: 1, 1: 1, 2: 2, 3: 23, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!