ID: 917406677_917406686

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 917406677 917406686
Species Human (GRCh38) Human (GRCh38)
Location 1:174714039-174714061 1:174714074-174714096
Sequence CCTTCCTTCCTCCCCAGTGGTAT CTTTTTCCTGCTCTTTGTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 396} {0: 1, 1: 0, 2: 4, 3: 38, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!