ID: 917439163_917439169

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 917439163 917439169
Species Human (GRCh38) Human (GRCh38)
Location 1:175051555-175051577 1:175051591-175051613
Sequence CCCAGATATCATCGAAGTCACCA CCCTAGAGTTTCTAGAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!