ID: 917475228_917475231

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 917475228 917475231
Species Human (GRCh38) Human (GRCh38)
Location 1:175363570-175363592 1:175363596-175363618
Sequence CCACTCTCATTCTGATGCAGCAT ACAGAGAAGAGGAAAAACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 212} {0: 1, 1: 0, 2: 2, 3: 37, 4: 476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!