ID: 917475228_917475233

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 917475228 917475233
Species Human (GRCh38) Human (GRCh38)
Location 1:175363570-175363592 1:175363605-175363627
Sequence CCACTCTCATTCTGATGCAGCAT AGGAAAAACGCAGGCAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 212} {0: 1, 1: 1, 2: 5, 3: 65, 4: 582}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!