ID: 917478141_917478144

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 917478141 917478144
Species Human (GRCh38) Human (GRCh38)
Location 1:175386374-175386396 1:175386389-175386411
Sequence CCTCCTTATGGAAGTCTGGTGAG CTGGTGAGTCAGAGAGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 92} {0: 1, 1: 1, 2: 2, 3: 78, 4: 659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!