ID: 917478318_917478328

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 917478318 917478328
Species Human (GRCh38) Human (GRCh38)
Location 1:175387750-175387772 1:175387793-175387815
Sequence CCCACCTCCTACTCTGTCTCCAG GCCGTCTTAGGCTGACCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 91, 4: 661} {0: 1, 1: 0, 2: 0, 3: 0, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!