ID: 917484658_917484663

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 917484658 917484663
Species Human (GRCh38) Human (GRCh38)
Location 1:175444751-175444773 1:175444774-175444796
Sequence CCAACAGGCTGCTGTTGGATACC ACTGCAGAGCCTTGCTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123} {0: 1, 1: 0, 2: 2, 3: 28, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!