ID: 917504502_917504504

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 917504502 917504504
Species Human (GRCh38) Human (GRCh38)
Location 1:175615539-175615561 1:175615559-175615581
Sequence CCCTGAGGCTTCGAGGTCACAGA AGAGCCTATGTGTCTCCTTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135} {0: 1, 1: 0, 2: 0, 3: 18, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!