ID: 917505994_917506009

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 917505994 917506009
Species Human (GRCh38) Human (GRCh38)
Location 1:175627685-175627707 1:175627733-175627755
Sequence CCATCCCCCATCCTTACCCACCC TCTACTTTCAAGTTAATCTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 138, 4: 1299} {0: 1, 1: 0, 2: 0, 3: 12, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!